Neurogenesis- Creation of Cortical Neurons from mESCs
This was part of a project I did at UoH. I'm not even sure if I should be putting this up here, tbh. It's only for the good I guess ;)
Abstract
Production of cortical
neurons is a fairly extensive yet beautiful procedure starting from mESCs to
NPCs to neurons. The neuronal precursors and neurons thus harvested can be used
to study epigenetic regulations characteristic of and involved in the
differentiation of neurons and related cells. In the followed protocol, a
defined medium with no morphogen has been used. Use of morphogen has been
replaced by an Shh inhibitor cyclopamine; thus, ensuring the differentiation of
ESCs into cortical neurons only. When NPCs and neurons are harvested at day 14
and day 21 respectively, several other kinds of cells may be obtained too which
are discarded off via FACS (Fluorescence Activated Cell Sorting). Also, no
feeder cells are being used. Instead, a coating of gelatin (until day 12) and
poly-L-lysine/laminin (from day 12) takes up the function of adhering the cells
to the plate.
Keywords
Neurogenesis | Mouse
Embryonic Stem Cells | Cortical Neurons | Stem Cells | NPCs | Embryonic
Development |
1.
Introduction
1.1. Revisiting Stem Cell
Biology
Embryonic cells are
famous shapeshifters capable of metamorphosing into all kinds of cells. If it
were not for this magical power of these cells, mere daughter cells of the
zygote that are homologous to each other, would not be able to form a whole
individual. The distinguishing properties of stem cells are that they are
capable of self-renewal, and differentiation.
A zygote giving rise to
an individual living entity is probably the most beautiful and miraculous event
happening in nature. The zygote, which is able to give rise to all cells,
including the ones of extra-embryonic origin, is said to be totipotent. The
zygote divides symmetrically with very less expression of cell adhesion
molecules until Day 8. Therefore, the cells are recognizable as discrete
entities. However, after Day 8, the boundaries of the cells become
indistinguishable cause of the expression of the adhesion molecules. This
phenomenon is termed as compaction. Peripheral cells grow closer to form dense
structure called trophoblast. Towards the inside, a fluid-filled cavity called
blastocoel is formed, which consists of the inner cell mass (ICM). The ICM is
house to pluripotent stem cells that can differentiate into cell-types of any
germ layer. Further into the differentiation, multipotent stem cells arise that
are capable of forming cells of only a particular germ layer, e.g. Neural Crest
Cells that are precursors to Schwann cells, melanocytes etc. Ultimately, a
unipotent stem cell results, e.g. Neural Progenitor Cells (NPCs).
Figure (1): Schematic
Representation of Stem Cell Potency and Differentiation
1.2. Brain Cells and
their Origin
The brain majorly
consists of two kinds of cells- neurons and neuroglial cells, or simply,
glia. Neurons are the communicating
cells self-stimulated and/or inter-stimulated by electrical impulses. Glial
cells, on the other hand, forms the support system of these cells. Glial cells
can further be divided into microglia and macroglia. Microglia forms the
Defence Forces of the brain as they give rise to brain-specific macrophages or
scavenger cells. Astrocytes which are involved in the control and formation of
blood brain barrier (BBB), Ependymal cells form the lining of the ventricular
surface called the choroid plexus, and secretes cerebrospinal fluid (CSF), and
Oligodendrocytes that play a major role in insulation of neurons in the central
nervous system (CNS) similar to the role of myelin in the peripheral nervous
system (PNS) constitute Macroglia.
Both glial cells and
neuronal cells are derived from Neural Progenitor Cells (NPCs), except for
microglia which originate from meningeal macrophages formed by primitive
haematopoesis in the yolk sac.
Neural progenitor cells
are multipotent cells capable of giving rise to mostly all cell types in the
CNS. These arise from pluripotent neuroepithelial cells (NECs) lining the
neural tube early on during embryonic development. There are two proliferative
zones identified- Ventricular (VZ) and Sub-ventricular (SVZ). NECs undergo
symmetrical and proliferative division. Primary NPCs arise from NECs early on
during development of the embryo in the VZ. These are arranged in a radial
manner, and hence, are called Radial Glia. These further give rise to basal
progenitor cells.
Initially, NECs go
through multiple cycles of self-renewal to increase the stem cell pool. Once
glial factors begin to express during and after the closure of the neural tube,
these cells are transformed into radial glia. Radia glia undergoes asymmetric and
neurogenic division(s), although initially, they expand via symmetric division
with the aim to increase the proliferative population in the ventricular zone.
In the asymmetric division, an NPC daughter cell is produced along with a
self-renewed radial glial cell. The NPC daughter cell then migrates to the
subventricular zone where it gives rise to two neuronal daughter cells. These
NPC daughter cells are called basal progenitor cells. Asymmetric division in
radial glia marks the beginning of cortical neurogenesis.
Figure (2): Neurogenesis
Lineage Tree
1.3. Significance of ESCs
In fertility clinics,
millions of ‘rejected’ embryos are discarded off on a regular basis. Although,
these don’t qualify to be transferred into a female’s body for further
development, these are goldmines of pluripotent stem cells. The ICM of the
otherwise to-be-discarded embryos are used to derive hESCs.
Disease modelling,
drug-screening, transplantation, and research in general found itself in a
major turning point with the advent of use of ESCs. It is indeed revolutionary
that one’s own body can turn to be a source of cells in transplantation
therapies, as well as in Disease-in-a-Dish models of patients with genetic
diseases. Studying the progression of diseases with genetic predisposition but
inconspicuous until symptoms arise, like Alzheimer’s, also becomes possible.
Both of these feats are achieved by the induced pluripotent stem cell
technology or iPS cell technology, as well as cell nuclear transplantation
technology wherein the chromosomes of the egg obtained is replaced with the
chromosomes of an adult.
Another application is
the study of certain cell-types that are rare to obtain. Obtaining neurons from
organ donors is pointless as stoppage of brain function is the characteristic
of death. Here’s where ESCs come into the picture. hESCs and mESCs provide a
great source of cells to be converted to neurons, although it’s quite a
work-intensive and extensive procedure.
1.4. Using mESCs
Commercial mESC line 46C originally
isolated from strain 129a was used.
Embryonic development
involves cell cleavage, compaction, growth, differentiation, development of
metabolism etc. However, a few animals like mouse, deer, and kangaroo have an
additional step between compaction and growth. This event is termed as
embryopause or diapause. In deers, when mating takes place in autumn, the
development is arrested at this stage until spring season arrives. Kangaroos
undergo a similar fate however, here, the deciding factor is the
already-occupied pouch. In mice, during unfavourable conditions, implantation
of the embryo is delayed, and it thus remains in the undifferentiated state in
the oviduct until conditions improve and implantation occurs.
mESC culture media
includes Leukemia Inhibitory Factor (LIF) primarily because it is necessary to
activate the JAK-STAT3 signalling pathway required for the continued
proliferation of these cells. Additionally, the significance of using LIF can
be confirmed as diapause is mediated by LIF.
2.
Methodology
Three plates (60mm) of
GFP-tagged mouse embryonic stem cell lines were cultured. In each of the cell
lines, the GFP was tagged to signature gene expression markers of ESCs, NPCs,
and neurons.
The methodology follows a
protocol that ensures neurogenesis whilst minimising exogenous influence as the
media used is well-defined, and promoting homogenous cell-to-cell interaction
by growing a monolayer culture with no embryonic bodies (EB) aggregates. There
is no morphogen being used. Instead, cyclopamine, a Sonic hedgehog (Shh)
inhibitor is used to ensure the differentiation of cortical neurons only. Also,
gelatin coating disposes off the necessity of feeder cells. As a result, feeder
contamination and the additional step of feeder layer removal are avoided
during differentiation.
2.1. Cell
Line Details
Cell line : 46C
Product name : E14TG2a
Product Code : ATCC-CRL-1821
Storage Conditions : Liquid Nitrogen Vapor; Temperature less
than -130oC
Growth
Conditions : 37oC, 95% air, 5% CO2
Animal : Mus musculus
Strain : 129a
Base medium : DMEM (Dulbecco’s Modified Eagle Medium)
Complete growth medium : Base
medium + FBS + NEAA+ Antibiotics + Nutrients
2.2. Culturing
the Cells
|
Reagent |
Significance |
|
Cyclopamine |
Ensures cortical neuron formation by
preventing dorsal neuronal differentiation. |
|
F12, B27 |
Nutrient
supplements. |
|
FBS |
Growth supplemengt containing all serum factors,
hormones, a-1-antitrypsin etc. Involved in cell attachment and proliferation. |
|
Glutamine |
Satisfies high energy demands of proliferating
cells. |
|
BME |
BME acts as antioxidant. |
|
LIF |
Increase time of selective adhesion procedure. |
|
Antibiotics- Penicillin, Streptomycin,
Amphotericin B |
Antibacterial, antiprotozoal, and
antifungal effect(s). |
Table (1): Reagents and
their Significance.
2.2.1. In
ESC Media (Cell expansion)
Three 60mm plates were
first coated with gelatin and was let stay for half an hour after which the
excess gelatin was decanted and the rest was made sure to dry completely. mESCs
do not secrete an extracellular matrix of their own so it becomes essential
that a surface ensuring the cells’ adhesion is performed. Feeder cells may also
be used. However, they have been avoided in this protocol due to reasons
mentioned earlier.
Meanwhile, ESCs were
thawed and brought into the laminar hood after sanitization. Cells in the
cryovial contains DMSO which was dissolved and discarded by adding them into a
fair amount of 10% FBS-supplemented DMEM. Once that was done, percentage
viability and seeding density was calculated using an automated cell counter.
Alternatively, a haemocytometer may also be used. 80-90% viability gives a
green signal for further proceedings. 5mL of the suspension (which equates to
around 150000 cells) was poured onto the 60mm culture plates. The cells were
then cultured in the same 10% FBS-supplemented DMEM under the aforementioned
growth conditions of 37oC, 5% CO2, and 95% air.
Preparing 10%
FBS-supplemented DMEM
To 44mL of DMEM, 5mL of
10% FBS was added. Additionally, 500uL each of antibiotics (streptomycin,
penicillin, and amphotericin B; 1x from 100 x stock), and non-essential amino
acids (NEAA; 1x from 100x stock) were added, making up a total of 50 mL of
media. Further, 2-mercaptoethanol (0.11mM from 0.55mM stock in PBS) and LIF (1x
from 2500x) were added directly to the cell culture.
Subculturing the Cells
When cell confluency
increases and they start to contact each other, subculturing must be performed
immediately as intercellular contact stimulates differentiation in ESCs. This
is done by trypsinising the cells. 0.5% trypsin is added into the cells culture
and light trituration is performed. Trypsin targets the basic amino acid side
chains, essentially suspending the cells from the gelatinous matrix into the
medium. Additionally, the commercial trypsin used has been enhanced with EDTA
that chelates divalent ions (Ca2+ and Mg2+) which might
otherwise decrease trypsin activity.
30s incubation follows.
Again, 10% FBS supplemented DMEM is added. Its antitrypsin activity (due to the
presence of a-1-antitrypsin)
neutralizes the leftover trypsin. Single cell suspension is ensured by
trituration. The suspended cells are pelleted out using a centrifuge. Pellet is
again dissolved in 10% FBS supplemented DMEM in the culture plates.
2.2.2. In
DDM
This step marks the
beginning of neurogenesis. Once ESCs attain a 50-60% confluency, 10% FBS
supplemented DMEM is replaced with DDM (Defined Default Medium). To prepare DDM
(30 mL), 300uL NEAA (1x from 100x stock), 14.38 mL DMEM, 14.38 mL F12
supplemented with GlutaMAX, and 300uL antibiotics (1x from 100x stock) were
taken in a falcon tube and mixed thoroughly. Additionally, 50uL N2 supplement
(1x from 100x stock), 9.1 uL 2-mercaptoethanol (0.11mM from 0.55mM stock in PBS),
and 50uL BSA (500ug/mL in PBS) was added into the cell culture. From day 3 to
day 9, cyclopamine was added to the medium in addition to DDM. Cyclopamine
functions by inhibiting the Sonic Hedgehog Pathway (Shh signalling pathway) by
binding with the ligand Smoothened (Smo) and thus making sure that dorsal
neurons are not formed. At day 12, media is changed from DDM to N2B27.
2.3. Subculturing
in N2B27 (to be done)
N2B27 is neurobasal and
B27 supplemented DDM. Additionally, glutamine and antibiotics would also be
added. It is made sure that B27 doesn’t contain Vitamin A which would result in
the formation of embryoid bodies.
DDM is removed and cells
are washed with PBS twice. Trypsinising is performed with 1mL 0.05% Trypsin and
incubated for more than two minutes. Meanwhile, culture plate is coated with
poly-L-lysine/laminin. The trypsinised cells are tapped and triturated before
adding 10% FBS + PBS. Centrifugation is performed and N2B27 is added.
N2B27
is a 1:1 formulation of DDM + Neurobasal/B27 (vitamin A-free) in addition to
glutamine and antibiotics.
2.4. Troubleshooting
|
Problem |
Possible Reasons |
Possible Solutions |
|
Excessive
cell death (beyond days 2–10) |
Improper
composition of culture media |
Prepare
new media |
|
|
Cell culture or
incubator infection |
Check for infection
(bacterial, fungal and mycoplasmal) |
|
Very few Nestin+
neural progenitors at day 14 and high proportion of non-neural cell types |
Improper ESC health |
Prepare new ES media.
Start from an earlier passage of ES cells |
|
|
Improper ESC dissociation |
Check trypsin
solution efficiency |
|
|
|
Increase cell
dissociation |
|
|
|
Try different
densities |
|
|
Suboptimal cell
density at plating |
Increase time of
selective adhesion procedure. |
|
Very few neurons at
day 21 |
Improper composition
of culture media |
Prepare new media |
|
|
Improper preparation
of coated coverslips |
Prepare new
coverslips and poly-L-lysine and laminin. |
|
|
Suboptimal cell
density at replating. |
Check trypsin
solution efficiency |
|
|
Improper dissociation |
Increase cell dissociation |
|
NPCs or neurons
obtained are not cortical |
B27 contains Vitamin
A |
Double check the
composition |
|
|
Suboptimal cell
density at plating |
Try different cell
densities |
Table (2): Troubleshooting
2.4. Analysis
In the culture plates,
many other cell types may also spring up. The cell of our interest will be
sorted out via FACS which will be outsourced.
Figure (1): Day 10, Compound Microscope Image
Once that is done,
the presence of the signature gene is checked via RT-PCR or IHC.
|
ESC |
Oct-4 |
|
NPC |
Sox-1 |
|
Neuron |
Tau |
Table (3): Gene
Expression Signatures of 46C mESC cell line (E14TG2a) isolated from strain 129a
List of RT-PCR
primers have been mentioned below-
|
Gene |
Forward primer
sequence (5′–3′) |
Reverse primer
sequence (5′–3′) |
Annealing T (°C) |
Amplicon size (bp) |
|
FoxG1 |
TGAAGAGGAGGTGGAGTGCC |
GCTGAACGAGGACTTGGGAA |
60 |
514 |
|
Emx2 |
CACCTTCTACCCCTGGCTCA |
TTCTCGGTGGATGTGTGTGC |
59 |
522 |
|
Emx1 |
CCCCTCACTCTCTTTCTTGAGCG |
CAGCCCATTCTCTTGTCCCTC |
58 |
622 |
|
Dlx1 |
CCAAAAGGGAAGCAGAGGAG |
CCCAGATGAGGAGTTCGGAT |
59 |
722 |
|
Lhx6 |
TAGAGCCTCCCCATGTACGCC |
TGCTGCGGTGTATGCTTTTT |
55 |
723 |
|
Nkx2.1 |
AACCTGGGCAACATGAGCGAGCTG |
ATCTTGACCTGCGTGGGTGTCAGG |
66 |
352 |
Table (4): PCR Primers
for Specific Biomarkers to be Used
3.
Anticipated Results
Cells harvested before
the addition of DDM (before day 0) will show positive results for its gene
expression signature Oct-4. Similarly, cells will show the characteristic gene
expression of Sox-1 when harvested at day 14, and of Tau when harvested at day
21.
4.
Conclusion
Neurogenesis has reached
its day 12 as of 28 June, 2022. Further protocol will be followed to derive
NPCs at day 14, and neurons at day 21. NPC-production will be confirmed via
RT-PCR on 1 July, 2022 (day 14). The same will be done on harvesting of cells
on day 21, except this time, confirming the obtainment of neuronal population. Derivation
of neurons opens up windows for studying neuronal development at the epigenetic
scale; especially, to study their properties such as the phenomenon of supercoiling
in neuronal DNA, and the significance of thyroid hormones (provided in vitro
via B27) in cortical neuronal development.
5.
References
Chen, C., Zhou, Z., Zhong, M., Zhang, Y., Li, M.,
Zhang, L., ... & Yu, Z. (2012). Thyroid hormone promotes neuronal
differentiation of embryonic neural stem cells by inhibiting STAT3 signaling
through TRα1. Stem cells and development, 21(14),
2667-2681.
Gaspard, N., Bouschet, T., Herpoel, A., Naeije, G., Van
Den Ameele, J., & Vanderhaeghen, P. (2009). Generation of cortical neurons
from mouse embryonic stem cells. Nature protocols, 4(10),
1454-1463.
Götz, M., & Huttner, W. B. (2005). The cell biology
of neurogenesis. Nature reviews Molecular cell biology, 6(10),
777-788.
Tabansky, I., & Stern, J. N. (2016). Basics of stem
cell biology as applied to the brain. Stem Cells in Neuroendocrinology,
11-24.
Comments
Post a Comment